Amaç: Bu çalışmada semptomatik ve asemptomatik primer hiperparatiroidi (PHPT) olgularını karşılaştırmayı amaçladık, beraberinde sporadik saptanan paratiroid adenomlarında etyopatogenezde CDKN1B mutasyonu varlılığını saptamaya çalıştık.
Gereç ve Yöntem: Çalışmamıza kliniğimize başvuran 80 PHPT (66 K ve 14 E, ortalama yaş 50.8 ± 12.01 yıl) tanısı almış hasta dahil edilmiştir. Hastaların yaş, cinsiyet, biyokimyasal parametreleri, görüntüleme yöntemleri (nükleer sintigrafi, ultrasonografi, kemik dansitometre ölçümü) kayıt edilmiştir. CDKN1B gen sekanslaması için GeneMATRIX Quick Blood DNA Purification kiti kullanılarak DNA izole edilmiştir. CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) ve CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) primerleri seçilerek mutasyon analizi yapılmıştır.
Bulgular: Çalışma sonucunda 22 hasta asemptomatik PHPT olarak tanımlanmış olup semptomatik PHPT (n=68) serum kalsiyum parametreleri ve 24 saatlik idrar Ca+ atılımı daha yüksek olarak saptanmıştır. Serum Parathormon (PTH) değerleri her iki grupta da benzerdi. Her iki grupta da CDKN1B mutasyonu açısından patolojik bir bulgu saptanmamıştır.
Sonuç: Parathormon seviyeleri semptomatik veya asemptomatik PHPT olgularında belirleyici bir parametre olmamakla birlikte semptomatik PHPT da serum kalsiyum değerleri ve 24 saatlik idrar Ca+ atılımı daha belirgindir.
Purpose: The aim of this study was to compare clinical, biochemical and treatment modalities of the patients with symptomatic and asymptomatic PHPT (primary hyperparathyroidism), and evaluate whether the CDKN1B mutation from these patients contributes to the pathogenesis of typical, sporadic parathyroid adenomas.
Materials and Methods: In this prospective study 80 patients (66 women and 14 men, mean age 50.8 ± 12.01 years) with PHPT were enrolled. Biochemical and clinical information were collected on patients’ sex, age, biochemical examination and radiological findings (nuclear 99 mTc sestamibi scans scintigraphy, cervical ultrasound). CDKN1B sequencing, and DNA isolation was performed by using GeneMATRIX Quick Blood DNA Purification Kit. Selected primer of CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) and CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) were amplified by polymerase chain reaction (PCR) (Solis Biodyne, Estonia).
Results: A total of 80 patients diagnosed with PHPT were included, of which 22 were symptomatic. Serum calcium and 24-hour calcium excretion were significantly increased in patients with symptomatic PHTP. Serum PTH levels were similar between the two group. PHPT. CDKN1B mutation was not detected in any patients.
Conclusion: Symptomatic patients were found to have elevated levels of calcium levels (hypercalcaemic), 24-hour urine calcium excretion and target organ damage (bone disease and nephrolithiasis). Independent of PTH levels, clinical signs and symptoms could be related with serum calcium parameters in these patients.
Primary Hyperparathyroidism symptomatic hyperparathyroidism asymptomatic hyperparathyroidism
Primary Language | Turkish |
---|---|
Subjects | Clinical Sciences |
Journal Section | Research |
Authors | |
Publication Date | June 30, 2022 |
Acceptance Date | May 24, 2022 |
Published in Issue | Year 2022 Volume: 47 Issue: 2 |