SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Year 2015, Volume: 16 Issue: 1, 45 - 49, 16.03.2016

Mehmet Aybeke

Abstract

Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr) Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR) methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s), 58°C for annealing (30 s) and 72°C for elongation (60 s), with an initial 94°C denaturation (3 min) and a 72°C extension (30 min). The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s), and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Keywords

Cereals, Puccinia, disease, molecular-assisted selection, breeding

Buğdayda Kahverengi Pas Hastalığına Dayanıklılığı Sağlayan Bazı Lr Genlerinin Multipleks PZR Metodu ile Taranması

Abstract

Kahverengi pas buğdaylarda önemli bir fungal hastalık olup bütün dünyada önemli verim kayıplarına neden olmaktadır.
Türkiye’de yapılan çalışmalarda Lr9, Lr19, Lr24 ve Lr28 gibi çeşitli Lr genlerinin bu hastalığa dayanıklılığı sağladığı tespit
edilmiştir. Bu genlerin çeşitlerde ve örneklerde ıslah süresince başarılı bir şekilde taranması önemlidir. Bu nedenle; çalışmada
esasen bu 4 geni içine alacak şekilde multipleks polimeraz zincir reaksiyonu (PZR) metodolojisinin başarılı bir şekilde tek
seferde uygulanabileceği bir yöntemin oluşturulması amaçlanmıştır. Çalışmada her bir gen için referans oluşturacak şekilde
pas kapan nörseri örnekleri kullanılmış ve ön denemelerdeki PZR şartları şu şekildedir: başlangıç denatürasyon initial 94°C’de
3 dk, denatürasyon 95°C’de (35 siklus, 30’ar sn), bağlanma (annealing) 58°C’de 30 s, uzama (elongation) 72°C’de 60 s ve son
uzatma (final extension) 72°C’de 30 dk. olmak üzeredir. Primerler: Lr9F: TCCTTTTATTCCGCACGCCGG,
Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA;
Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG;
Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. Genelde tüm genler için ortak olmak
üzere optimum bağlanma sıcaklığının, 61°C, uzatma sıcaklığının 62°C or 64°C olduğu tespit edilmiştir. Sonuç olarak, yeni
PCR metodu ile tek gel taşıyan örneklerde başarılı bir şekilde taranma yapılmıştır. Optimal Multipleks PCR koşulları:
denatürasyon 94°C’da 1 dk., 35 siklus [94°C’da 30 s., 61°C’da 30 s annealing ve 64–68°C’de 2 dk. extention] ve final
extension 72°C’de 30 dk. olarak tespit edilmiştir. İlaveten; optimize multipleks PCR testleri ile Lr19, Lr24 ve Lr28 taşıyan çok
genli örneklerde pozitif sonuçlar da alınmıştır. Çalışmanın bundan sonraki diğer Lr genleri ile büyütülmesi hedeflenmektedir. 

Keywords

Tahıllar, Puccinia, hastalık, moleküler destekli seleksiyon, ıslah

References

• Anonym, 2015. Generale directorate of agricultural research and policiesAvailable at: Republic of Turkey, Ministry of Food, Agriculture and Livestock [online web]. Available at: http://www.tarim.gov.tr/TAGEM/Menu/27/Pdgt (Date accessed: 3.7.2015)
• Bhawar, Kailash B., Vinod, Sharma, J.B., Singh, A.K., Sivasamy, M., Mona Singh, Prabhu, K.V., Tomar. S.M.S., Sharma T.R. & Singh, B. 2011. Molecular marker assisted pyramiding of leaf rust resistance genes Lr19 and Lr28 in bread wheat (Triticum aestivum L.) variety HD2687. Indian Journal of Genetics, 71 (4): 304-311.
• Cherukuri, D.P., Gupta, S.K., Charpe, A., Koul, S., Prabhu, K.V., Singh, R.B. & Rizwanul Haq, Q.M. 2005. Molecular mapping of Aegilops speltoides derived leaf rust resistance gene Lr28 in wheat. Euphytica 143: 19–26.
• Henegariu, O., Heerema, N.A., Dlouhy, S.R., Vance, G.H. & Vogt, P.H. 1997. Multiplex PCR: Critical Parameters and Step-by-Step Protocol. BioTechniques 23:504-511.
• Henegariu, O. 2015. Troubleshooting for PCR and multiplex PCR [online website]. Available at: http://www.mudphudder.com/wp-content/uploads/2009/03/pcr-troubleshooting.pdf (Date accessed: 30.06.2015).
• Germán, S., Barcellos, A., Chaves, M., Kohli, M., Campos, P. & Viedma, L. 2007. The situation of common wheat rusts in the Southern Cone of America and perspectives for control. Australian Journal of Agricultural Research, 58 (6): 620-630.
• Moullet, O., Fossati, D., Mascher, F., Guadagnolo, R. & Schori, A. 2009. Use of marker-assisted selection (MAS) for pyramiding two leaf rust resistance genes, (Lr9 and Lr24) in wheat [online website]. Available at: http://www.agroscope.admin.ch/amelioration-des-plantes/00713/01864/06200/index.html?lang=en (Date accessed: 30.06.2015)
• Nocente, F., Gazza L. & Pasquini, M. 2007. Evaluation of leaf rust resistance genes Lr1, Lr9, Lr24, Lr47 and their introgression into common wheat cultivars by marker-assisted selection. Euphytica, 155, 329–336.
• Quiagen, 2015. DNeasy® Plant Mini Kit according to the protocol (online website). Available at: https://www.qiagen.com/in/products/catalog/sample-technologies/rna-sample-technologies/rna-cleanup/dneasy-plant-mini-kit?Print=1 (Date accessed: 3.7.2015)
• Vanzetti, L.S., Campos, P., Demichelis, M., Lombardo, L.A., Aurelia, P.R., Vaschetto, L.M., Bainotti, C.T. & Helguera, M. 2011. Identification of leaf rust resistance genes in selected Argentinean bread wheat cultivars by gene postulation and molecular Markers. Electronic Journal of Biotechnology. Available at: http://www.ejbiotechnology.info, DOI: 10,2225/vol14-issue3-fulltext-14.
• Li X., Yang, W.X., Li, Y.N., Liu, D.Q., Yan, H.F., Meng, Q.F. & Zang, T. 2007. Identification of AFLP Markers Linked to Lr19 Resistance to Wheat Leaf Rust. Agricultural Sciences in China, 6 (3): 311–315.